Archives

  • 2018-07
  • 2019-04
  • 2019-05
  • 2019-06
  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2019-12
  • 2020-01
  • 2020-02
  • 2020-03
  • 2020-04
  • 2020-05
  • 2020-06
  • 2020-07
  • 2020-08
  • 2020-09
  • 2020-10
  • 2020-11
  • 2020-12
  • 2021-01
  • 2021-02
  • 2021-03
  • 2021-04
  • c-myc inhibitor The lungs dissected from week mice were cut

    2021-04-07

    The lungs dissected from 4–5-week mice were cut into small pieces and then immersed in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) containing collagenase II (2 mg/ml), trypsin (2.5 mg/ml), Dnase I (2 mg/ml), penicillin (100 U/ml), and streptomycin (100 μg/ml) for 12 hours at 37 °C after phosphate-buffered saline wash. The clumps of tissues were removed through filtering and the cells were collected from the supernatant by centrifuge, followed by their maintenance in Dulbecco's modified Eagle's medium supplemented with heat-inactivated 10% fetal bovine serum (FBS). The phenotypes of fibroblasts after passage 3 were characterized by immunostaining of the epithelial marker pan-cytokeratin and the fibroblastic marker vimentin. For functional studies, the cells were used between passages 4 and 6. To induce the cell differentiation, the cells were stimulated with 10 ng/ml TGF-β1 (PeproTech, Rocky Hill, NJ) or cultured on collagen I (Roche Diagnostics, Mannheim, Germany)-coated surface (8 μg/cm2) for 48 hours. Recombinant adenovirus expressing EGFP or full length DDR2 was packaged and purified by Vector Gene Technology Company (Beijing, China), and used to infect the cells with 10 viral particles/cell. For inhibition of ERK pathway, the cells were pretreated with 20 μmol/l PD98059 (Calbiochem, San Diego, CA) or dimethyl sulfoxide. Human healthy (20 subjects) and IPF (4 males and 2 females) lung tissue sections were obtained from Biomax (Rockville, MD). The study protocol was approved by the ethics committee of the Fourth Military Medical University. Paraffin sections of mouse lungs (4 μm) were prepared for H&E and Masson's trichrome staining or immunohistochemistry. Masson's trichrome staining was performed according to the manufacturer's instructions (Baso, Zhuhai, China). For immunohistochemical detection of DDR2 and α-SMA, the sections were dewaxed and rehydrated through graded alcohol and then subject to antigen retrieval by high pressure cooking for 2 minutes in 10 mmol/l citrate c-myc inhibitor (pH 6.0). The antibodies against human DDR2 (R&D Systems, Minneapolis, MN) and human α-SMA (Abcam, Cambridge, UK) were used at a dilution of 1: 100 and 1 : 200, respectively. Rabbit or mouse immunoglobulin G (IgG) was used as a negative control. Antibody binding was visualized by a horseradish peroxidase-conjugated secondary antibody system (Sigma-Aldrich, St. Louis, MO). The cDNAs of wild-type human DDR2 or a kinase-dead mutant DDR2 (K608EDDR2) that have been described earlier were inserted into lentiviral pCDH vector (Provided by Professor Jian Zhang, The Fourth Military Medical University, Xi'an, China). For the package of virus, human embryo kidney 293T-cells from the American Type Culture Collection were transiently transfected with pCDH, PMD2.G, and PSPAX2 at a ratio of 4 : 1 : 3 with Lipofectamin2000 (Invitrogen) according to the manufacturer's instructions. Forty-eight hours after transfection, the supernatant were collected and then 1 ml of them was used to infect lung fibroblasts seeded on six-well plate. A commercial hydroxyproline kit from Jiancheng Institute of Biotechnology (Nanjing, China) was used following the provider's instructions. Briefly, fresh lung tissues were weighted and hydrolyzed to release hydroxyproline. After a series of chemical reactions, a pink color solution was formed and then subjected to measurement of absorbance at 560 nm. The hydroxyproline content of each sample was calculated by comparing with the standards. Results were expressed as micrograms of hydroxyproline per gram wet lung weight. Total RNA was extracted using the RNeasy kit (QIAGEN Hilden, Germany). cDNA was synthesized using the Super-Script II First-Strand Synthesis System (Invitrogen). qPCR was performed using a Prism 7500 real-time thermocycler (Applied BioSystems San Diego, CA). The primer sequences for mouse Ddr2, Gapdh, Vegf-a, Ang-1, and Fgf-2 have been described earlier., Mouse α-SMA: GACGCTGAAGTATCCGATAGAACACG (forward); CACCATCTCCAGAGTCCAGCACAAT (reverse); mouse Tgf-β1: AGCGGACTACTATGCTAAAGAGGTCACCC (forward); CCAAGGTAACGCCAGGAATTGTTGCTATA (reverse); mouse col1α1: CATGTTCAGCTTTGTGGACC (forward); TTCTGTACGCAGGTGATTGG (reverse). qPCR data indicate the relative mRNA expression level of target gene. Gapdh was used as an internal reference control. Bar graphs are the mean ± SD of three separate experiments.